Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow:
mRNA Sequence: 5’– UCAUUAACCCAGAUCUUCUUAAAAGGA –3’
How many amino acids will be formed from the given codons, if substitution of ‘U’ by ‘C’ takes place at the 5th codon? Explain your answer.
Show Hint
Substitutions in codons can change amino acids, altering protein structure and function.
The sequence is updated to 5’- UCAUUAACCCAGACCUUCUUAAAAGGA-3’. The 5th codon is altered from UCU to CCU, resulting in the coding of Proline instead of Serine. Amino acids = Total codons – Stop codon = 8.